1. Search Result
Search Result
Pathways Recommended: Anti-infection
Results for "

HBV infection

" in MedChemExpress (MCE) Product Catalog:

44

Inhibitors & Agonists

1

Screening Libraries

2

Peptides

3

Natural
Products

Targets Recommended:
Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-145713

    HBV Infection
    HBV-IN-19 inhibits hepatitis B virus (HBV) infection. Inhibiting HBsAg secretion and/or production is a strategy for the treatment of HBV infection, including chronic HBV infection .
    HBV-IN-19
  • HY-145713A

    HBV Infection
    HBV-IN-19 TFA inhibits hepatitis B virus (HBV) infection. Inhibiting HBsAg secretion and/or production is a strategy for the treatment of HBV infection, including chronic HBV infection .
    HBV-IN-19 TFA
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-W676876

    HBV Infection
    Oxynitidine is an HBV inhibitor (ID50=30.8 µg/mL), which can effectively inhibit the DNA replication activity of HBV. Oxynitidine can be used in the study of viral infections .
    Oxynitidine
  • HY-P3465

    Myrcludex B

    HBV Infection
    Bulevirtide (Myrcludex B) is a NTCP inhibitor, a linear lipopeptide of 47 amino acids. Bulevirtide inhibits HBV and HDV entry into liver cells, blocks HBV infection in hepatocytes, and participates in HBV transcriptional suppression. Bulevirtide can be used in HDV infection and compensated cirrhosis research .
    Bulevirtide
  • HY-131596

    (-)-Emtricitabine triphosphate

    HIV Infection
    Emtricitabine triphosphate ((-)-Emtricitabine triphosphate) is the phosphorylated anabolite of Emtricitabine (HY-17427). Emtricitabine is a nucleoside reverse transcriptase inhibitor. Emtricitabine is antiretroviral agent for HIV and HBV infection .
    Emtricitabine triphosphate
  • HY-N8168

    HBV Infection
    LPRP-Et-97543 is a potent anti-HBV agent. LPRP-Et-97543 reduces Core, S, and preS but not X promoter activities. LPRP-Et-97543 can be used for acute and chronic HBV infections research .
    LPRP-Et-97543
  • HY-144047

    HBV DNA/RNA Synthesis Infection
    HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1) .
    HBV-IN-16
  • HY-144045

    HBV DNA/RNA Synthesis Infection
    HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5) .
    HBV-IN-14
  • HY-144046

    HBV DNA/RNA Synthesis Infection
    HBV-IN-15 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-15 is a flavone derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2020052774A1, compound 2) .
    HBV-IN-15
  • HY-N12840

    Others Metabolic Disease
    Logmalicid B is an iridoid glycoside compound that can be isolated from Cornus officinalis and can be used in diabetes research .
    Logmalicid B
  • HY-156702

    HBV Infection
    HBV-IN-38 (Example 193) is an HBV DNA inhibitor (EC50≤100nM). HBV-IN-38 can be used to study viral infections .
    HBV-IN-38
  • HY-148781

    HBV Infection
    HBV-IN-30 (ex44), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-30 has the potential for the research of HBV infection .
    HBV-IN-30
  • HY-148780

    HBV Infection
    HBV-IN-29 (ex8), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-29 has the potential for the research of HBV infection .
    HBV-IN-29
  • HY-122209

    HBV Infection
    DVR-01 is a HBV inhibitor with EC50 values of 1.7 and 1.6 μM in AML12HBV10 and HepDES19 cells, respectively. DVR-01 shows antiviral activity against drug-resistant HBV mutants with EC50s of 2.403-3.273 μM. DVR-01 can be used for the research of HBV infection and related diseases .
    DVR-01
  • HY-148560

    HBV DNA/RNA Synthesis Infection
    ccc_R08 is a non-cytotoxic and orally active cccDNA inhibitor that reduces cccDNA levels in the liver of HBV-infected mice. ccc_R08 can be used in the study of HBV virus (hepatitis B virus) infection .
    ccc_R08
  • HY-B0277A

    ara-AMP; ara-A 5'-monophosphate

    HBV Antibiotic Infection
    Vidarabine phosphate (Ara-AMP), an antiviral agent, inhibits chronic HBV infection . Vidarabine phosphate also against herpes simplex and varicella zoster viruses .
    Vidarabine phosphate
  • HY-17426
    Famciclovir
    1 Publications Verification

    BRL 42810

    HSV HBV Infection
    Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection .
    Famciclovir
  • HY-145592

    RO7020531; RG7854

    Toll-like Receptor (TLR) Infection
    Ruzotolimod is the agonist of TLR7. Ruzotolimod has the potential for the research of HBV, COVID-19 or SARS-CoV-2 infection (extracted from patent WO2021130195A1) .
    Ruzotolimod
  • HY-147321

    Tau Protein HBV Infection Neurological Disease
    3'-DMTr-dG(iBu) is a nucleoside for the synthesis of nucleic acid, such as antiviral agents used in the research of viral infection (HBV, HDV), and oligonucleotides against Alzheimer’s disease and other tauopathies .
    3'-DMTr-dG(iBu)
  • HY-107902

    HBV HCV HIV Influenza Virus Infection
    RIG-1 modulator 1 is an anti-viral compound which can be useful for the treatment of viral infections including influenza virus, HBV, HCV and HIV extracted from patent WO 2015172099 A1.
    RIG-1 modulator 1
  • HY-109137

    GS-9688

    Toll-like Receptor (TLR) HBV Infection
    Selgantolimod (GS-9688) is an orally active, potent and selective toll-like receptor 8 (TLR8) agonist for the treatment of hepatitis B virus (HBV) and human immunodeficiency virus (HIV) infection .
    Selgantolimod
  • HY-147255

    ZM-H1505R

    HBV Infection
    Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. .
    Canocapavir
  • HY-147255A

    (S)-ZM-H1505R

    Others Infection
    (S)-Canocapavir is the isomer of Canocapavir (HY-147255A). Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B .
    (S)-Canocapavir
  • HY-148560B

    HBV Infection
    cis-ccc_R08 (compound 1) is a flavonoid derivative that can be used in the study of hepatitis B virus (HBV) infection. cis-ccc_R08 is a cccDNA (covalently closed circular DNA) inhibitor .
    cis-ccc_R08
  • HY-137453B

    (1R)-HS-10234

    HBV HIV Infection
    (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is the isomer of Tenofovir amibufenamide, is an orally active antiviral agent. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is a HIV infection inhibitor and HBV infection inhibitor. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) can be used for HIV infections, hepatitis B research .
    (1R)-Tenofovir amibufenamide
  • HY-145055

    HBV Infection
    HBV-IN-11 is a potent HBsAg secretion inhibitor with an EC50 of 0.46 µM (From patent WO2018085619A1, example 28) .
    HBV-IN-11
  • HY-17426R

    Infection
    Famciclovir (Standard) is the analytical standard of Famciclovir. This product is intended for research and analytical applications. Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection .
    Famciclovir (Standard)
  • HY-148201

    HBV Infection
    Oleana-2,12-dien-28-oic acid is an HBV-DNA inhibitor, HBsAg and HBeAg inhibitor. Oleana-2,12-dien-28-oic acid can be used in hepatitis B virus infection disease research .
    Oleana-2,12-dien-28-oic acid
  • HY-P3601

    FGF basic (1-24)

    Bacterial HBV Infection Inflammation/Immunology
    Brain Derived Basic Fibroblast Growth Factor (1-24) (FGF basic 1-24) is a synthetic peptide, shows anti-bacterial and anti-HBV activities. Brain Derived Basic Fibroblast Growth Factor (1-24) can be used in infection disease and immune disease research .
    Brain Derived Basic Fibroblast Growth Factor (1-24)
  • HY-13859

    L-FMAU

    HBV DNA/RNA Synthesis Orthopoxvirus Infection
    Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent anti-HBV activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice .
    Clevudine
  • HY-109195
    Vebicorvir
    1 Publications Verification

    ABI-H0731

    HBV Infection Inflammation/Immunology
    Vebicorvir (ABI-H0731) is a first-generation hepatitis B virus (HBV) core protein inhibitor. Vebicorvir (ABI-H0731) suppresses covalently closed circular DNA (cccDNA) formation in two de novo infection models with EC50s from 1.84 μM to 7.3 μM .
    Vebicorvir
  • HY-148560A

    HBV Infection
    trans-ccc_R08 (compound 1-B) is a potent cccDNA (covalently closed circular DMA) inhibitor. trans-ccc_R08 inhibits HBeAg level with an IC50 value of 0.08 µM. trans-ccc_R08 has the potential for the research of Hepatitis B Virus infection (HBV) .
    trans-ccc_R08
  • HY-145059

    HBV Infection
    HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). HBV-IN-12 shows anti-HBV DNA activity (0.001 μM<EC50 ≤0.02 μM). From patent WO2021204252A1, compound 15 .
    HBV-IN-12
  • HY-145060

    HBV Infection
    HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor. From patent WO2021204252A1, compound 1_B .
    HBV-IN-13
  • HY-145053

    HBV Infection
    HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). From patent WO2021204258A1, compound 6 .
    HBV-IN-10
  • HY-145053A

    HBV Infection
    (5S,8R)-HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). From patent WO2021204258A1, compound 6 .
    (5S,8R)-HBV-IN-10
  • HY-111003

    NZ-4

    HBV Infection
    Isothiafludine is an orally active non-nucleosidic anti-HBV compound. Isothiafludine inhibits hepatitis B virus replication by blocking pregenomic RNA encapsidation .
    Isothiafludine
  • HY-149357

    HBV Infection
    Yhhu6669 is an anti-HBV agent. Yhhu6669 inhibits HBV DNA. Yhhu6669 inhibits HBV replication by inducing the formation of DNA-free capsids. Yhhu6669 decreases HBV DNA and HBcAg in AAV/HBV-infected mice. Yhhu6669 has favorable PK properties .
    Yhhu6669
  • HY-145871

    HBV Infection
    BA38017 is a potent HBV core protein assembly modulator. BA38017 inhibits HBV replication with an EC50 of 0.20 μM .
    BA38017
  • HY-163124

    HBV Infection
    HBV-IN-43 (compound 5832) is a potent inhibitor of HBV .
    HBV-IN-43
  • HY-W352344

    HBV Infection
    2'-Deoxy-L-adenosine is an orally active synthon for modified oligodeoxyribonucleotides. 2'-Deoxy-L-adenosine is a potent, specific and selective inhibitor of the replication of hepatitis B virus (HBV) as well as the closely related duck and woodchuck hepatitis viruses (WHV) .
    2'-Deoxy-L-adenosine
  • HY-151134

    HBV Infection
    HBV-IN-25 is a good potency, orally active novel HBV cccDNA reducer. HBV-IN-25 has anti-HBeAg potency and anti-HBV activity with IC50 values of 0.58 μM and 1.15 μM, respectively. HBV-IN-25 has good aqueous solubility (LYSA>452 μg/mL) and good PK property with no cellular toxicity .
    HBV-IN-25

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: